dna fragment synthesized from Search Results


90
GenScript corporation chemically synthesized dna fragment for ptc promoter region (−758 to +130)
Chemically Synthesized Dna Fragment For Ptc Promoter Region (−758 To +130), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc11721587-350-1-13?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
chemically synthesized dna fragment for ptc promoter region (−758 to +130) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega klenow dna polymerase end-filled bamhi/hindiii fragment from pabcluc
Klenow Dna Polymerase End Filled Bamhi/Hindiii Fragment From Pabcluc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/10__1074_slash_jbc__m305791200-69-11-21?v=Promega
Average 90 stars, based on 1 article reviews
klenow dna polymerase end-filled bamhi/hindiii fragment from pabcluc - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence
Synthesized Dna Fragment Containing A Hepatitis D Virus Ribozyme (Hdvr) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc09778660-136-3-18?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega an ecori dna fragment obtained from plasmid pkk3535 previously cloned in a pgen vector
An Ecori Dna Fragment Obtained From Plasmid Pkk3535 Previously Cloned In A Pgen Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/10__1128_slash_jcm__41__4__1617___1622__2003-84-24-26?v=Promega
Average 90 stars, based on 1 article reviews
an ecori dna fragment obtained from plasmid pkk3535 previously cloned in a pgen vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation synthetic dna fragment specifying the codon p54q change from ccg to cag
Synthetic Dna Fragment Specifying The Codon P54q Change From Ccg To Cag, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc07000558__mmc2-136-29-39?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
synthetic dna fragment specifying the codon p54q change from ccg to cag - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega ecori-ncoi dna fragment purified from the pcat basic vector
Ecori Ncoi Dna Fragment Purified From The Pcat Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/10__1128_slash_mcb__15__11__6013-111-25-28?v=Promega
Average 90 stars, based on 1 article reviews
ecori-ncoi dna fragment purified from the pcat basic vector - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragment containing the comt2 gene
Dna Fragment Containing The Comt2 Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/us10883124-1364-6-13?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
dna fragment containing the comt2 gene - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation swai-aflii synthesized dna fragments
Swai Aflii Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc04272407-161-16-20?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
swai-aflii synthesized dna fragments - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation chimera containing the gh5-cbm3 domains from bscel5a linked by peptides of variable length
Chimera Containing The Gh5 Cbm3 Domains From Bscel5a Linked By Peptides Of Variable Length, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc04917841-131-12-24?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
chimera containing the gh5-cbm3 domains from bscel5a linked by peptides of variable length - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Metabion International AG synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3
Synthesized Dna Fragment 5’ Cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc03788786-62-16-19?v=Metabion+International+AG
Average 90 stars, based on 1 article reviews
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GenScript corporation npea dna fragment coding a region from amino acids 90–170
Npea Dna Fragment Coding A Region From Amino Acids 90–170, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/pmc11253601-63-8-13?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
npea dna fragment coding a region from amino acids 90–170 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega dna fragments from 2a5-3λ dna
Dna Fragments From 2a5 3λ Dna, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/dna+fragment+synthesized+from/us07294481-271-6-15?v=Promega
Average 90 stars, based on 1 article reviews
dna fragments from 2a5-3λ dna - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results