90
|
GenScript corporation
chemically synthesized dna fragment for ptc promoter region (−758 to +130) Chemically Synthesized Dna Fragment For Ptc Promoter Region (−758 To +130), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc11721587-350-1-13?v=GenScript+corporation Average 90 stars, based on 1 article reviews
chemically synthesized dna fragment for ptc promoter region (−758 to +130) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
klenow dna polymerase end-filled bamhi/hindiii fragment from pabcluc Klenow Dna Polymerase End Filled Bamhi/Hindiii Fragment From Pabcluc, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/10__1074_slash_jbc__m305791200-69-11-21?v=Promega Average 90 stars, based on 1 article reviews
klenow dna polymerase end-filled bamhi/hindiii fragment from pabcluc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence Synthesized Dna Fragment Containing A Hepatitis D Virus Ribozyme (Hdvr) Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc09778660-136-3-18?v=GenScript+corporation Average 90 stars, based on 1 article reviews
synthesized dna fragment containing a hepatitis d virus ribozyme (hdvr) sequence - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
an ecori dna fragment obtained from plasmid pkk3535 previously cloned in a pgen vector An Ecori Dna Fragment Obtained From Plasmid Pkk3535 Previously Cloned In A Pgen Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/10__1128_slash_jcm__41__4__1617___1622__2003-84-24-26?v=Promega Average 90 stars, based on 1 article reviews
an ecori dna fragment obtained from plasmid pkk3535 previously cloned in a pgen vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
synthetic dna fragment specifying the codon p54q change from ccg to cag Synthetic Dna Fragment Specifying The Codon P54q Change From Ccg To Cag, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc07000558__mmc2-136-29-39?v=GenScript+corporation Average 90 stars, based on 1 article reviews
synthetic dna fragment specifying the codon p54q change from ccg to cag - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
ecori-ncoi dna fragment purified from the pcat basic vector Ecori Ncoi Dna Fragment Purified From The Pcat Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/10__1128_slash_mcb__15__11__6013-111-25-28?v=Promega Average 90 stars, based on 1 article reviews
ecori-ncoi dna fragment purified from the pcat basic vector - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
dna fragment containing the comt2 gene Dna Fragment Containing The Comt2 Gene, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/us10883124-1364-6-13?v=GenScript+corporation Average 90 stars, based on 1 article reviews
dna fragment containing the comt2 gene - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
swai-aflii synthesized dna fragments Swai Aflii Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc04272407-161-16-20?v=GenScript+corporation Average 90 stars, based on 1 article reviews
swai-aflii synthesized dna fragments - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
chimera containing the gh5-cbm3 domains from bscel5a linked by peptides of variable length Chimera Containing The Gh5 Cbm3 Domains From Bscel5a Linked By Peptides Of Variable Length, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc04917841-131-12-24?v=GenScript+corporation Average 90 stars, based on 1 article reviews
chimera containing the gh5-cbm3 domains from bscel5a linked by peptides of variable length - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 Synthesized Dna Fragment 5’ Cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag 3, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc03788786-62-16-19?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
synthesized dna fragment 5’-cttaatcaagcttcggggacttagtctcctccctgggtttggacactggcatcctgctttatgtgtgacaccactgcacccctctgagcctcggtttccccatctgtaaaatag-3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
npea dna fragment coding a region from amino acids 90–170 Npea Dna Fragment Coding A Region From Amino Acids 90–170, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/pmc11253601-63-8-13?v=GenScript+corporation Average 90 stars, based on 1 article reviews
npea dna fragment coding a region from amino acids 90–170 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Promega
dna fragments from 2a5-3λ dna Dna Fragments From 2a5 3λ Dna, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/dna+fragment+synthesized+from/us07294481-271-6-15?v=Promega Average 90 stars, based on 1 article reviews
dna fragments from 2a5-3λ dna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |